- ADVERTISEMENT ABOVE -
What follows is a rough explanation of how a Y-chromosome DNA test allows two or more men sharing the Bricker surname to see if they're related and, if so, how closely.
The lab work involves analyzing unique segments of DNA at certain pre-determined locations along the Y-chromosome of each man. Each of these locations is called a microsatellite or YSTR marker , and each one of the markers that Family Tree DNA examines has been given a name, such as DYS 458 or DYS 385a. In fact, DYS stands for DNA Y-chromosome Segment.
The illustration above shows the location of 25 markers used by Family Tree DNA along a male Y-chromosome. Only markers in blue are used in the 12-marker test, and both those markers and the additional 13 markers in black are used in the 25-marker test.
Depending on whether the 12-marker or 25-marker test has been ordered from FTDNA, those people who have submitted a sample of their DNA for analysis will receive a result from the lab that shows a particular number or allele found at each of these markers, such as a "14" or "31" or "9" or "24", depending on the range of alleles possible for a given marker. See figure, below. Each of these alleles reflects the number of times a certain segment of DNA has been repeated at the Y-chromosome Short Tandem Repeat or YSTR marker where it was found. So, an allele of "11" at a given marker would mean 11 repeats, and would be different from an allele of either "10" or "12", with respectively 10 and 12 repeats.
Here's an example of an allele of 11 repeats of "GATA", one possible segment of DNA, at DYS 19:
GATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA
Other possibilities could have been some four-letter combination of "C", "T", "G" and "A", which stand for cytosine, thymine, guanine, and adenine, respectively. In the example chosen above, the letters that appear in "GATA" and the order in which they appear reflect the underlying chemical composition and arrangement of the DNA at that particular location on the chromosome.
The importance of alleles for genetic genealogy lies in the fact that the allele at each marker checked along a Y-chromosome together form a series of alleles which is that person's "genetic signature", properly called a haplotype. Here is an example of a haplotype for a certain anonymous "Bricker #1", a living descendent of the immigrant John Bricker who settled in Frederick County, Maryland:
| D | 3 | 3 | 3 | 3 | 3 | 3 | 4 | 3 | 4 | 3 | 3 | 3 |
| Y | 9 | 9 | 9 | 9 | 8 | 8 | 2 | 8 | 3 | 8 | 9 | 8 |
| S | 3 | 0 | 4 | 1 | 5 | 5 | 6 | 8 | 9 | 9 | 2 | 9 |
| # | a | b | i | ii | ||||||||
| Alleles | 13 | 22 | 13 | 9 | 12 | 15 | 11 | 12 | 12 | 14 | 11 | 30 |
Bricker #1 has an allele of 13 at marker DYS 393, an allele of 22 at marker DYS 390, and so on, up to the final allele of 30 for DYS 389 II in the case of the 12-marker test. Taken together, the series of 12 numbers, the result of testing Bricker #1's Y-chromosome DNA, constitute his haplotype, although the haplotype is more refined with the greater number of markers checked, such as it is for a 25-marker test.
It's the particular alleles a male has, and the order which they occur in the series, that indicates the genetic record he's inherited from his father, father's father, and so on, back into time, like the family name. On very rare occasion, however, instead of the passing on of an exact copy of an allele from father to son, a small and harmless change or mutation occurs so that the son, Bricker #1 for example, may have an allele of 9 at marker DYS 391 instead of the 10 his father has. The haplotype, or genetic signature, of father and son would therefore be slightly different. See the figure, below.
On the other hand, the father may pass on an unchanged allele of 10 to another son, a brother of Bricker #1, and so for many generations afterward the haplotype of the line of Bricker #1, with allele 9 at marker DYS 391, may be distinguished, through genetic testing at that location on his Y-chromosome, from the haplotype of the line of Bricker #1's brother, with allele 10 for the same marker at the same location on his own respective Y-chromosome.
At this point, it's important to stress that no haplotype contains any personal information that would identify specifically who "Bricker #1" or any Bricker is, and in fact has no value in and of itself. The value of a person's haplotype for genealogy is only when it's compared to someone else's haplotype to determine if they are both related, and approximately when their most recent common ancestor lived.
The more the markers that are analyzed, the more basis there is for comparison with the haplotypes of other people to see whether there is indeed a relationship and, if so, how close those relationships are. And the more numbers, or alleles, that two men have matching at each marker tested, the likelier that they are descended from the same ancestor and the closer their relationship is. However, often only 12 markers are necessary to see if there is a relationship or not between two men.
To show this, the illustration below gives a comparison of the hypothetical DNA test results of "Bricker #1" with the results for a second Bricker, called "Bricker #2", a descendent of the immigrant Peter Bricker who settled in Lancaster County, Pennsylania in 1732.
| D | 3 | 3 | 3 | 3 | 3 | 3 | 4 | 3 | 4 | 3 | 3 | 3 | |
| Y | 9 | 9 | 9 | 9 | 8 | 8 | 2 | 8 | 3 | 8 | 9 | 8 | |
| S | 3 | 0 | 4 | 1 | 5 | 5 | 6 | 8 | 9 | 9 | 2 | 9 | |
| # | a | b | i | ii | NAMES | ||||||||
| 13 | 22 | 13 | 9 | 12 | 15 | 11 | 12 | 12 | 14 | 11 | 30 | Bricker #1 | |
| Alleles | 13 | 24 | 13 | 10 | 11 | 13 | 12 | 12 | 13 | 14 | 13 | 31 | Bricker #2 |
Let's compare the alleles for Bricker #1 and Bricker #2. What do we see? Bricker #2 has alleles, shown in red, that differ from those of Bricker #1 at eight out of twelve markers. They share the same alleles at only four markers: DYS 393, DYS 394, DYS 388, and DYS 389-i. The rule of thumb is that in a 12-marker test, two men with the same last name can conceivably only come from the same line if they share twelve, eleven, or occasionally ten alleles out of twelve at those markers.
There's no doubt here that Bricker #1 and Bricker #2 either (1) do come from entirely different Bricker lines with no genetic relationship, or (2) one and even conceivably both of them descent from separate lines in which a non-Bricker was adopted into a Bricker family, or was the product of a so-called false paternity event (i.e., extramarital birth).
In the first case, these two unrelated Bricker families with distinctly different haplotypes, their lines separately established in the U.S. by John Bricker in Frederick County, MD and Peter Bricker in Lancaster County, PA, would have each adopted the Bricker surname 500 to 600 years ago in Europe, when having last names first came widely into fashion. Each of these Bricker lines likely came from two entirely different European locations. The fact that both lines now share the same last name in North America is only due to chance, not common ancestry.
As dissimilar as they are to one another, the haplotypes of Bricker #1 and Bricker #2 are no doubt quite similar to the haplotypes of others in their respective Bricker lines. To give other examples, those men joining the Project who would in fact be descended from Adam Bricker of Westmoreland County, PA, or from Ludwig Bricker of York County, PA, will find that they match or nearly match the haplotype of other men descended from the same ancestor, at least at the 12-marker level. Once a genetic relationship is established with a given Bricker line, Project participants may opt to upgrade to a 25-marker DNA test in order to tease out the subtle but distinctive genetic signatures characteristic of each of the various branches of the same Bricker line.
When a project participant's own haplotype is very dissimilar from any of the haplotypes typical of the various Bricker lines, this provides a strong argument for also testing at least one and even two of his known living male Bricker relatives, the more distant the better. The results of an additional participant can validate the results of the first, and establish the existence of yet another Bricker line, to which a given Bricker and his patrilineal relative(s) belong.
However, if the haplotype of a participant remains dissimilar from any other participant in the project, then even though a family tree on paper may show him to be of Bricker descent, the implication is that there was a now-unknown adoption or false paternity event somewhere back in his direct line. In fact, it's estimated that adoptions and false paternity events together are involved in some 2-5% of conceptions in every generation, so the possibility is far from remote.
| D | 3 | 3 | 3 | 3 | 3 | 3 | 4 | 3 | 4 | 3 | 3 | 3 | |
| Y | 9 | 9 | 9 | 9 | 8 | 8 | 2 | 8 | 3 | 8 | 9 | 8 | |
| S | 3 | 0 | 4 | 1 | 5 | 5 | 6 | 8 | 9 | 9 | 2 | 9 | |
| # | a | b | i | ii | NAMES | ||||||||
| 13 | 24 | 13 | 10 | 11 | 13 | 12 | 12 | 13 | 14 | 13 | 31 | Bricker #2 | |
| Alleles | 13 | 24 | 13 | 10 | 11 | 13 | 12 | 12 | 12 | 14 | 13 | 31 | Bricker #3 |
As more and more Brickers participate in the project, Bricker #2 may discover that a new project participant, such as Bricker #3 in the table above, matches or nearly matches his haplotype at the 12-marker test level. Here, Bricker #3 has only one allele, at marker DYS 391, which is different from Bricker #2.
In this case, the two men would have a very good reason to compare their genealogies on paper as well as to upgrade to the 25-marker test. This is because, despite the fact that the two would only have a 50% probability of sharing a Most Recent Common Ancestor or MRCA within 37 generations from the present (see table below), there would still be a 60% chance that they shared the same alleles in 23 or 24 markers in the 25-marker test.
This in turn is important because the more evidence there is that two men share a greater number of alleles, the closer toward the present their MRCA is likely to be. The table above indicates that there is a 50% probability that men who share the same alleles at 23 out of 25 markers will have a MRCA within 28 generations, and at 24 out of 25 markers one within 17 generations.
When project participants sharing the Bricker surname have alleles that match in all loci in the 12-marker test, not only does it means that there is a 99.9% likelihood that they have a common ancestor, but also that there's a 50% likelihood that the common ancestor is within the last 14.5 generations, or 350 years, where a generation is equal to 25 years. Here, the incentive for an upgrade is the evidence that exists of an 80% chance that they'd also share the same alleles in 23, 24, or all 25 of the markers in the 25-marker test.
In our example above, if Bricker #2 and Bricker #3 had discovered that their haplotypes both matched at the 12-marker test, an up-grade which again resulted in a match, at all 25 markers, would give a 50% probability that they shared a MRCA within 7 generations, which would be about 175 years ago or approximately the year 1830.
In the end, DNA evidence can act to confirm credible genealogical evidence pointing to a relationship between two or more men with the same last name, and can help to focus further investigations of their common family history.
In the table below are the 13 additional markers, from DYS 458 through DYS 464d, which are examined by the lab when there is an upgrade to a total of 25 markers.
| Markers | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 | 25 | |
| D | 3 | 3 | 3 | 3 | 3 | 3 | 4 | 3 | 4 | 3 | 3 | 3 | 4 | 4 | 4 | 4 | 4 | 4 | 4 | 4 | 4 | 4 | 4 | 4 | 4 | |
| Y | 9 | 9 | 9 | 9 | 8 | 8 | 2 | 8 | 3 | 8 | 9 | 8 | 5 | 5 | 5 | 5 | 5 | 4 | 3 | 4 | 4 | 6 | 6 | 6 | 6 | |
| S | 3 | 0 | 4 | 1 | 5 | 5 | 6 | 8 | 9 | 9 | 2 | 9 | 8 | 9 | 9 | 5 | 4 | 7 | 7 | 8 | 9 | 4 | 4 | 4 | 4 | |
| # | a | b | i | ii | a | b | a | b | c | d | NAMES | |||||||||||||||
| 13 | 24 | 13 | 10 | 11 | 13 | 12 | 12 | 13 | 14 | 13 | 31 | ? | ? | ? | ? | ? | ? | ? | ? | ? | ? | ? | ? | ? | Bricker #2 | |
| Alleles | 13 | 24 | 13 | 10 | 11 | 13 | 12 | 12 | 12 | 14 | 13 | 31 | ? | ? | ? | ? | ? | ? | ? | ? | ? | ? | ? | ? | ? | Bricker #3 |
For more detailed information on genetic genealogy, see the Blair Surname DNA Project's excellent DNA 101
Suggestions for improving the content or appearance of this webpage are welcomed.
- ADVERTISEMENT -